Conserved primer sequences for PCR amplification of fungal rDNA

Note: the original web site describing our primer sequences expired in July 2017;  I have reposted the original information here.  Click here for a pdf version.   -R. Vilgalys, Aug 2018

Primer sites within the ribosomal RNA genes of fungi

Over the years, our lab has compiled a useful list of conserved primer sequences useful for amplification and sequencing of nuclear rDNA from most major groups of fungi (primarily Eumycota), as well as other eukaryotes. All of these primers were first identified and tested by our own lab based on consensus between the published large and small subunit RNA sequences from fungi, plants and other eukaryotes; sources of other useful primer sequences from published literature are also indicated. Together, these primers span most of the nuclear rDNA coding region (see figures), permitting amplification of any desired region. Standard symbols are used for the four primary nucleotides; variable positions are indicated as follows: P=A,G / Q=C,T / R=A,T / V=A,C / W=G,T. Primers ending with “R” represent the coding strand (same as RNA). All other primers are complementary to the coding strand. This information is provided freely and may be passed on to anyone who wants to use it.

Organization of ribosomal RNA genes in fungi. Multiple copies of near-identical rDNA operons are organized in a head-to-toe manner on a single chromosome.

The nuclear-encoded ribosomal RNA genes (rDNA) of fungi exist as a multiple-copy gene family comprised of highly similar DNA sequences (typically from 8-12 kb each) arranged in a head-to-toe manner. Each repeat unit has coding regions for one major transcript (containing the primary rRNAs for a single ribosome), punctuated by one or more intergenic spacer (IGS) regions. In some groups (mostly basidiomcyetes and some ascomycetous yeasts), each repeat also has a separately transcribed coding region for 5S RNA whose position and direction of transcription may vay among groups. Several restriction sites for EcoRI and BglII are conserved in the rDNA of fungi. Nearly all basidiomycetes we’ve studied share an EcoRI site within the 5.8S RNA gene along with a BglII site halfway into the LSU RNA sequence. Primers 5.8SR and LR7 include these restriction sites, which makes them convenient for cloning.

For those who aren’t familiar with rDNA and fungal systematics, several excellent reviews are available on fungi (Hibbett, 1992) and generally for eukaryotes (Hillis and Dixon, 1991). See Gerbi (1986) for a general introduction to the molecular biology and evolution of rDNA in other eukaryotes. Another useful source of primer information may be found in Gargas & Depriest (1996) and at the Tom Bruns lab web site http://mendel.berkeley.edu/boletus/boletus.html.

SSU (small-subunit 18S RNA) primer sequences  
Primer name Sequence (5′–>3′) Position within S. cereviseae 17S RNA
BMB-‘A’ GRATTACCGCGGCWGCTG 580-558
BMB-‘B’ CCGTCAATTCVTTTPAGTTT 1146-1127
BMB-‘C’ ACGGGCGGTGTGTPC 1638-1624
BMB-BR CTTAAAGGAATTGACGGAA 1130-1148
BMB-CR GTACACACCGCCCGTCG 1624-1640
SR1R TACCTGGTTGATQCTGCCAGT 564-578
SR1 ATTACCGCGGCTGCT 578-564
SR2 CGGCCATGCACCACC 1277-1263
SR3 GAAAGTTGATAGGGCT 318-302
SR4 AAACCAACAAAATAGAA 838-820
SR5 GTGCCCTTCCGTCAATT 1146-1130
SR6 TGTTACGACTTTTACTT 1760-1744
SR6R AAGWAAAAGTCGTAACAAGG 1744-1763
SR7 GTTCAACTACGAGCTTTTTAA 617-637
SR7R AGTTAAAAAGCTCGTAGTTG 637-617
SR8R GAACCAGGACTTTTACCTT 732-749
SR9R QAGAGGTGAAATTCT 896-910
SR10R TTTGACTCAACACGGG 1181-1196
NS1 GTAGTCATATGCTTGTCTC
NS2 GGCTGCTGGCACCAGACTTGC
NS3 GCAAGTCTGGTGCCAGCAGCC
NS CTTCCGTCAATTCCTTTAAG (similar to BMB-B)
NS5 AACTTAAAGGAATTGACGGAAG (is similar to BMB-BR)
NS6 GCATCACAGACCTGTTATTGCCTC
NS7 GAGGCAATAACAGGTCTGTGATGC
NS8 TCCGCAGGTTCACCTACGGA
BMB = “universal” SSU primers developed by Lane et al., 1985
SR = primers developed by Vilgalys lab
NS = primers described by White et al., 1990

 

LSU  (large subunit 25-28S RNA)
Primer name Sequence (5′–>3′) Position within S. cereviseae rRNA comments
5.8S CGCTGCGTTCTTCATCG 51-35 (5.8S RNA) contains EcoRI site
5.8SR TCGATGAAGAACGCAGCG 34-51 (5.8S RNA) contains EcoRI site
LR0R ACCCGCTGAACTTAAGC 26-42
LR1 GGTTGGTTTCTTTTCCT 73-57
LR2 TTTTCAAAGTTCTTTTC 385-370
LR2R AAGAACTTTGAAAAGAG 374-389
LR3 CCGTGTTTCAAGACGGG 651-635
LR3R GTCTTGAAACACGGACC 638-654
LR4 ACCAGAGTTTCCTCTGG 854-838
LR5 TCCTGAGGGAAACTTCG 964-948
LR6 CGCCAGTTCTGCTTACC 1141-1125
LR7 TACTACCACCAAGATCT 1448-1432 contains BglII site
LR7R GCAGATCTTGGTGGTAG 1430-1446 contains BglII site
LR8 CACCTTGGAGACCTGCT 1861-1845
LR8R AGCAGGTCTCCAAGGTG 1845-1861
LR9 AGAGCACTGGGCAGAAA 2204-2188
LR10 AGTCAAGCTCAACAGGG 2420-2404
LR10R GACCCTGTTGAGCTTGA 2402-2418
LR11 GCCAGTTATCCCTGTGGTAA 2821-2802
LR12 GACTTAGAGGCGTTCAG 3124-3106
LR12R CTGAACGCCTCTAAGTCAGAA 3106-3126
LR13 CGTAACAACAAGGCTACT 3357-3340
LR14 AGCCAAACTCCCCACCTG 2616-2599
LR15 TAAATTACAACTCGGAC 154-138
LR16 TTCCACCCAAACACTCG 1081-1065
LR17R TAACCTATTCTCAAACTT 1033-1050
LR20R GTGAGACAGGTTAGTTTTACCCT 2959-2982
LR21 ACTTCAAGCGTTTCCCTTT 424-393
LR22 CCTCACGGTACTTGTTCGCT 364-344

Note: Many of these primers were first reported in several papers (Hopple and Vilgalys, Hibbett and Vilgalys, Vilgalys and Hester, ).  Most molecular systematics studies only utilize the first 600-900 bases from the LSU gene, which includes three divergent domains (D1, D2, D3) that are among the most variable regions within the entire gene (much of the LSU is invariant even across widely divergent taxa). Most of the data in our Agaricales LSU database consists of the first 900 bases from the LSU gene (we typically amplify using primers 5.8SR + LR7, followed by sequencing using primers LR5, LR16, LR0R, and LR3R).

ITS (internal transcribed spacer) region primers
primer name sequence (5′->3′) comments reference
ITS1 TCCGTAGGTGAACCTGCGG White et al, 1990
ITS2 GCTGCGTTCTTCATCGATGC (similar to 5.8S White et al, 1990
ITS3 GCATCGATGAAGAACGCAGC (similar to 5.8SR) White et al, 1990
ITS4 TCCTCCGCTTATTGATATGC White et al, 1990
ITS5 GGAAGTAAAAGTCGTAACAAGG (similar to SR6R) White et al, 1990
ITS1-F CTTGGTCATTTAGAGGAAGTAA Gardes & Bruns, 1993
ITS4-B CAGGAGACTTGTACACGGTCCAG Gardes & Bruns, 1993
5.8S CGCTGCGTTCTTCATCG Vilgalys lab
5.8SR TCGATGAAGAACGCAGCG Vilgalys lab
SR6R AAGWAAAAGTCGTAACAAGG Vilgalys lab

Notes on ITS:  The ITS region is the most widely sequenced DNA region for Fungi. It has typically been most useful for molecular systematics at the species level, and even within species (e.g., to identify geographic races). Because of its higher degree of variation than other genic regions of rDNA (SSU and LSU), variation among individual rDNA repeats can sometimes be observed within both the ITS and IGS regions. In addition to the standard ITS1+ITS4 primers used by most labs, numerous taxon-specific primers have been described that allow selective amplification of fungal sequences (e.g., see Gardes & Bruns 1993 paper describing amplification of basidiomycete ITS sequences from mycorrhiza samples).

IGS (intergenic spacer primers, including 5S RNA primer sequences primarily for basidiomycete fungi)
primer name sequence (5′->3′) comments reference
LR12R GAACGCCTCTAAGTCAGAATCC located within the LSU RNA (see above) Vilgalys lab
invSR1R ACTGGCAGAATCAACCAGGTA located within the SSU RNA (positions 21-1) Vilgalys lab
5SRNA ATCAGACGGGATGCGGT (complementary to 5S RNA positions 46-26) Vilgalys lab
5SRNAR ACQGCATCCCGTCTGAT (5S RNA positions 26-46) Vilgalys lab

Notes on IGS region: The greatest amount sequence variation in rDNA exists within the IGS region (sometimes also known as the non-transcribed spacer or NTS region). The size of the IGS region may vary from 2 kb upwards. It is not unusual to find hypervariability for this region (necessitating cloning of individual repeat haplotypes). Several patterns of organization can be found in different groups of fungi: 1. Most filamentous ascomycetes have a single uninterrupted IGS region (between the end of the LSU and start of the next SSU sequence), which may vary in length from 2-5 kb or more.  Amplification of the entire IGS region requires using primers anchored in the 3′ end of the LSU gene (e.g., LR12R) and 5′ end of the SSU RNA gene (e.g., invSR1R); 2. In many ascomycetous yeasts and nearly all basidiomycetes, the IGS also contains a single coding region for the 5S RNA gene, which divides the IGS into two smaller regions that may be more easily amplified using. Depending on the orientation and position of the 5S RNA gene, PCR may be used to sequentially amplify a portion of the intergenic spacer region (IGS) beyond the large subunit RNA coding region.

 

REFERENCES

Bruns, T. D., R. Vilgalys, S. M. Barns, D. Gonzalez, D. S. Hibbett, D. J. Lane, L. Simon, S. Stickel, T. M. Szaro, W. G. Weisburg, and M. L. Sogin. 1992. Evolutionary relationships within the fungi: analyses of nuclear small subunit rRNA sequences. Molec. Phylog. Evol. 1: 231-241.

Bruns, T. D., T. J. White, and J. W. Taylor. 1991. Fungal molecular systematics. Ann. Rev. Ecol. Syst. 22: 525-564.

DePriest, P. T., and M. D. Been. 1992. Numerous group I introns with variable distributions in the ribosomal DNA of a lichen fungus. J. Mol. Biol. 228: 315-321.

Elwood, H. J., G. J. Olsen, and M. L. Sogin. 1985. The small subunit ribosomal RNA gene sequences from the hypotrichous ciliates Oxytricha nova and Stylonychia pustula. Mol. Biol. Evol. 2: 399-410.

Gardes, M., and T. D. Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes – application to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118.

Gargas, A., and P.T. DePriest. 1996. A nomenclature for fungal PCR primers with examples from intron-containing SSU rDNA.
Mycologia 88: 745-748

Gargas, A., and J.W. Taylor. 1992. Polymerase chain reaction (PCR) primers for amplifying and sequencing 18S rDNA from
lichenized fungi. Mycologia 84: 589-592.

Gerbi, S. A. 1986. Chapter 7 – Evolution of ribosomal DNA. Pp. 419-517 In: Molecular evolution, ed. McIntyre, R.

Hibbett, D. S. 1991. Phylogenetic relationships of the Basidiomycete genus Lentinus: evidence from ribosomal RNA and morphology. Ph.D. Thesis, Duke University, 1991.

Hibbett, D. S. 1992. Ribosomal RNA and fungal systematics. Trans. Mycol. Soc. Jpn. 33: 533-556.

Hibbett, D. S., and R. Vilgalys. 1991. Evolutionary relationships of Lentinus to the Polyporaceae: evidence from restriction analysis of enzymatically amplified ribosomal DNA. Mycologia 83: 425-439.

Hibbett, D. S., and R. Vilgalys. 1993. Phylogenetic relationships of the Basidiomycete genus Lentinus inferred from molecular and morphological characters. Syst. Bot. 18: 409-433.

Hillis, D. M., and M. T. Dixon. 1991. Ribosomal DNA: molecular evoluiton and phylogenetic inference. Quart. Rev. Biol. 66: 411-453.

Hopple JS, Vilgalys R (1999) Phylogenetic relationships in the mushroom genus Coprinus and dark-spored allies based on sequence data from the nuclear gene coding for the large ribosomal subunit RNA: divergent domains, outgroups, and monophyly. Molecular Phylogenetics and Evolution 13:1–19. doi: 10.1006/mpev.1999.0634

Hopple, J. S., Jr., and R. Vilgalys. 1994. Phylogenetic relationship among coprinoid taxa and allies based on data from restriction site mapping of nuclear rDNA. Mycologia 86: 96-107.

Lane, D. J., B. Pace, G. J. Olsen, D. A. Stahl, M. L. Sogin, and N. R. Pace. 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci., U. S. A. 82: 6955-6959.

Vilgalys, R., and D. Gonzalez. 1990. Organization of ribosomal DNA in the basidiomycete Thanatephorus praticola. Curr. Genet. 18: 277-280.

Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J Bacteriol 172:4238–4246.

Vilgalys, R., J. S. Hopple, Jr., and D. S. Hibbett. 1994. Phylogenetic implications of generic concepts in fungal taxonomy: The impact of molecular systematic studies. Mycologica Helvetica 6: 73-91.

White, T. J., T. Bruns, S. Lee, and J. W. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 In: PCR Protocols: A Guide to Methods and Applications, eds. Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, Inc., New York.